Stem-loop sequence hsa-mir-5692b

AccessionMI0019311 (change log)
Symbol HGNC:MIR5692B
DescriptionHomo sapiens miR-5692b stem-loop
Stem-loop
   --g       gaau         gua     u       aa  u 
5'    auauuau    aauaucaca   ggugu cacacau  ug g
      |||||||    |||||||||   ||||| |||||||  ||  
3'    uaugaug    uuauagugu   ccaca gugugua  ac u
   cug       aagu         -ac     u       cc  a 
Get sequence
Deep sequencing
23 reads, 0 reads per million, 19 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr21: 42950928-42951014 [-]
sense
OTTHUMT00000195196 ; AP006748.1-001; intron 1
ENST00000418874 ; AP006748.1-001; intron 1
Database links

Mature sequence hsa-miR-5692b

Accession MIMAT0022497
Sequence

10 - 

aauaauaucacaguaggugu

 - 29

Get sequence
Deep sequencing17 reads, 15 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21980368 "MicroRNAs associated with metastatic prostate cancer" Watahiki A, Wang Y, Morris J, Dennis K, O'Dwyer HM, Gleave M, Gout PW, Wang Y PLoS One. 6:e24950(2011).