Stem-loop sequence hsa-mir-5692a-1

AccessionMI0019297 (change log)
Symbol HGNC:MIR5692A1
DescriptionHomo sapiens miR-5692a-1 stem-loop
Gene family MIPF0001351; mir-5692
Stem-loop
   gacag           c    gu        - uc 
5'      uacaaauaaua caca  ggguguac c  a
        ||||||||||| ||||  |||||||| |   
3'      auguuuauuau gugu  cccacaug g  u
   cuaua           a    --        u ug 
Get sequence
Deep sequencing
183 reads, 0 reads per million, 51 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 97963658-97963726 [+]
antisense
OTTHUMT00000334684 ; BAIAP2L1-004; intron 1
OTTHUMT00000334681 ; BAIAP2L1-001; intron 3
OTTHUMT00000334682 ; BAIAP2L1-002; intron 3
ENST00000473569 ; BAIAP2L1-004; intron 1
ENST00000005260 ; BAIAP2L1-001; intron 3
ENST00000462558 ; BAIAP2L1-002; intron 3
Clustered miRNAs
< 10kb from hsa-mir-5692a-1
hsa-mir-5692a-1chr7: 97963658-97963726 [+]
hsa-mir-5692c-2chr7: 97964405-97964481 [-]
Database links

Mature sequence hsa-miR-5692a

Accession MIMAT0022484
Sequence

8 - 

caaauaauaccacagugggugu

 - 29

Get sequence
Deep sequencing275 reads, 42 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21980368 "MicroRNAs associated with metastatic prostate cancer" Watahiki A, Wang Y, Morris J, Dennis K, O'Dwyer HM, Gleave M, Gout PW, Wang Y PLoS One. 6:e24950(2011).