Stem-loop sequence hsa-mir-5691

AccessionMI0019296 (change log)
Symbol HGNC:MIR5691
DescriptionHomo sapiens miR-5691 stem-loop
Stem-loop
        ag uu         u     aa     a 
5' ggaca  c  gcucugagc ccgag  agcug c
   |||||  |  ||||||||| |||||  ||||| a
3' ccugu  g  cgagacuug gguuc  ucgac g
        cu uu         u     -g     a 
Get sequence
Deep sequencing
33 reads, 0 reads per million, 23 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 9090312-9090379 [-]
sense
OTTHUMT00000385812 ; SCUBE2-005; intron 5
OTTHUMT00000376180 ; SCUBE2-003; intron 5
OTTHUMT00000376181 ; SCUBE2-001; intron 5
ENST00000309263 ; SCUBE2-005; intron 5
ENST00000450649 ; SCUBE2-003; intron 5
ENST00000520467 ; SCUBE2-001; intron 5
ENST00000457346 ; SCUBE2-201; intron 5
Database links

Mature sequence hsa-miR-5691

Accession MIMAT0022483
Sequence

9 - 

uugcucugagcuccgagaaagc

 - 30

Get sequence
Deep sequencing33 reads, 23 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21980368 "MicroRNAs associated with metastatic prostate cancer" Watahiki A, Wang Y, Morris J, Dennis K, O'Dwyer HM, Gleave M, Gout PW, Wang Y PLoS One. 6:e24950(2011).