Stem-loop sequence hsa-mir-5690

AccessionMI0019295 (change log)
Symbol HGNC:MIR5690
DescriptionHomo sapiens miR-5690 stem-loop
Stem-loop
                   c            gauuug 
5' cuuuuaauuucagcua uaccucuauuag      g
   |||||||||||||||| ||||||||||||      g
3' gagaauuaaaguugau auggagauaauc      a
                   a            auauug 
Get sequence
Deep sequencing
905 reads, 0 reads per million, 94 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 35664717-35664789 [-]
sense
ENST00000536438 ; FKBP5-201; intron 2
Database links

Mature sequence hsa-miR-5690

Accession MIMAT0022482
Sequence

10 - 

ucagcuacuaccucuauuagg

 - 30

Get sequence
Deep sequencing794 reads, 90 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21980368 "MicroRNAs associated with metastatic prostate cancer" Watahiki A, Wang Y, Morris J, Dennis K, O'Dwyer HM, Gleave M, Gout PW, Wang Y PLoS One. 6:e24950(2011).