Stem-loop sequence hsa-mir-569

AccessionMI0003576 (change log)
Symbol HGNC:MIR569
DescriptionHomo sapiens miR-569 stem-loop
Gene family MIPF0000535; mir-569
Literature search

3 open access papers mention hsa-mir-569
(6 sentences)

Stem-loop
   -    uu    ga        g     --       aac   aucagaa 
5'  ggua  guua  uuaauuuu uggga  cauuaac   agc       g
    ||||  ||||  |||||||| |||||  |||||||   |||        
3'  uuau  cagu  aauugaaa guccu  guaauug   ucg       c
   u    uu    -g        g     aa       auu   acuacaa 
Get sequence
Deep sequencing
4 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 171106664-171106759 [-]
sense
OTTHUMT00000352973 ; TNIK-001; intron 1
OTTHUMT00000352975 ; TNIK-003; intron 1
OTTHUMT00000352976 ; TNIK-004; intron 1
OTTHUMT00000352977 ; TNIK-005; intron 1
OTTHUMT00000352978 ; TNIK-006; intron 1
OTTHUMT00000352979 ; TNIK-007; intron 1
OTTHUMT00000352980 ; TNIK-008; intron 1
OTTHUMT00000352981 ; TNIK-009; intron 1
OTTHUMT00000352974 ; TNIK-002; intron 1
ENST00000436636 ; TNIK-001; intron 1
ENST00000341852 ; TNIK-003; intron 1
ENST00000284483 ; TNIK-004; intron 1
ENST00000475336 ; TNIK-005; intron 1
ENST00000357327 ; TNIK-006; intron 1
ENST00000460047 ; TNIK-007; intron 1
ENST00000488470 ; TNIK-008; intron 1
ENST00000470834 ; TNIK-009; intron 1
ENST00000465393 ; TNIK-002; intron 1
ENST00000369326 ; TNIK-201; intron 1
ENST00000538048 ; TNIK-202; intron 1
Database links

Mature sequence hsa-miR-569

Accession MIMAT0003234
Sequence

61 - 

aguuaaugaauccuggaaagu

 - 81

Get sequence
Evidence experimental; SAGE [1]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).