Stem-loop sequence hsa-mir-5689

AccessionMI0019294 (change log)
Symbol HGNC:MIR5689
DescriptionHomo sapiens miR-5689 stem-loop
Stem-loop
                                       gg 
5' agcgugguagcauacaccuguaguccuagauacuca  a
   ||||||||||||||||||||||||||||||||||||   
3' ucgcaccaucguguguggacaucaggaucuaugagu  g
                                       gg 
Get sequence
Deep sequencing
898 reads, 9.24 reads per million, 119 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 10439717-10439794 [+]
sense
OTTHUMT00000039813 ; RP1-290I10.7-001; intron 1
OTTHUMT00000039814 ; RP1-290I10.7-002; intron 1
ENST00000449333 ; RP1-290I10.7-001; intron 1
ENST00000366312 ; RP1-290I10.7-002; intron 1
Database links

Mature sequence hsa-miR-5689

Accession MIMAT0022481
Sequence

9 - 

agcauacaccuguaguccuaga

 - 30

Get sequence
Deep sequencing392 reads, 72 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21980368 "MicroRNAs associated with metastatic prostate cancer" Watahiki A, Wang Y, Morris J, Dennis K, O'Dwyer HM, Gleave M, Gout PW, Wang Y PLoS One. 6:e24950(2011).