Stem-loop sequence hsa-mir-5688

AccessionMI0019292 (change log)
Symbol HGNC:MIR5688
DescriptionHomo sapiens miR-5688 stem-loop
Stem-loop
               cu         a    a         gg 
5' gaaacacuuugc  uuuuacagg guuu uuauguuuu  a
   ||||||||||||  ||||||||| |||| |||||||||  c
3' cuuugugaaacg  aaaaugucc caaa aauacaaag  a
               ac         a    c         au 
Get sequence
Deep sequencing
40 reads, 0 reads per million, 16 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 85385710-85385792 [+]
sense
OTTHUMT00000352818 ; CADM2-002; intron 1
OTTHUMT00000352822 ; CADM2-006; intron 1
ENST00000383699 ; CADM2-002; intron 1
ENST00000407528 ; CADM2-006; intron 1
Database links

Mature sequence hsa-miR-5688

Accession MIMAT0022479
Sequence

52 - 

uaacaaacaccuguaaaacagc

 - 73

Get sequence
Deep sequencing37 reads, 15 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21980368 "MicroRNAs associated with metastatic prostate cancer" Watahiki A, Wang Y, Morris J, Dennis K, O'Dwyer HM, Gleave M, Gout PW, Wang Y PLoS One. 6:e24950(2011).