Stem-loop sequence hsa-mir-5687

AccessionMI0019291 (change log)
Symbol HGNC:MIR5687
DescriptionHomo sapiens miR-5687 stem-loop
Stem-loop
      -c      c            c          uac 
5' ccu  acuuau ugacucugaaau uucuaaaugg   c
   |||  |||||| |||||||||||| ||||||||||    
3' gga  ugaaua acugggauuuug aagauuuauu   c
      ca      a            c          uca 
Get sequence
Deep sequencing
294 reads, 0 reads per million, 68 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr5: 55508850-55508926 [-]
sense
OTTHUMT00000368511 ; ANKRD55-002; intron 1
OTTHUMT00000368515 ; ANKRD55-006; intron 1
OTTHUMT00000368510 ; ANKRD55-001; intron 2
OTTHUMT00000374824 ; ANKRD55-008; intron 2
ENST00000504958 ; ANKRD55-002; intron 1
ENST00000513241 ; ANKRD55-006; intron 1
ENST00000341048 ; ANKRD55-001; intron 2
ENST00000519114 ; ANKRD55-008; intron 2
Database links

Mature sequence hsa-miR-5687

Accession MIMAT0022478
Sequence

47 - 

uuagaacguuuuagggucaaau

 - 68

Get sequence
Deep sequencing108 reads, 39 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21980368 "MicroRNAs associated with metastatic prostate cancer" Watahiki A, Wang Y, Morris J, Dennis K, O'Dwyer HM, Gleave M, Gout PW, Wang Y PLoS One. 6:e24950(2011).