Stem-loop sequence hsa-mir-5685

AccessionMI0019287 (change log)
Symbol HGNC:MIR5685
DescriptionHomo sapiens miR-5685 stem-loop
Stem-loop
                   a                 cucc 
5' cucuacaucacagccc gcaguuaucacgggccc    c
   |||||||||||||||| |||||||||||||||||    c
3' gagauguagugucggg cgucaauagugcccggg    u
                   a                 uaac 
Get sequence
Deep sequencing
38 reads, 21.4 reads per million, 28 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 53276993-53277071 [+]
intergenic
Database links

Mature sequence hsa-miR-5685

Accession MIMAT0022475
Sequence

10 - 

acagcccagcaguuaucacggg

 - 31

Get sequence
Deep sequencing14 reads, 13 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21980368 "MicroRNAs associated with metastatic prostate cancer" Watahiki A, Wang Y, Morris J, Dennis K, O'Dwyer HM, Gleave M, Gout PW, Wang Y PLoS One. 6:e24950(2011).