Stem-loop sequence hsa-mir-5684

AccessionMI0019285 (change log)
Symbol HGNC:MIR5684
DescriptionHomo sapiens miR-5684 stem-loop
Literature search

1 open access papers mention hsa-mir-5684
(1 sentences)

Stem-loop
       a           a         ug  a 
5' gcug acucuagccug gcaacagag  ag u
   |||| ||||||||||| |||||||||  || g
3' ugac ugaggucggac cguuguuuu  uc g
       c           c         gu  u 
Get sequence
Deep sequencing
3696 reads, 46 reads per million, 150 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 12787128-12787192 [+]
antisense
OTTHUMT00000462713 ; DHPS-007; exon 1
OTTHUMT00000462709 ; DHPS-021; intron 2
OTTHUMT00000462706 ; DHPS-008; intron 3
OTTHUMT00000462710 ; DHPS-003; intron 6
OTTHUMT00000462711 ; DHPS-005; intron 6
OTTHUMT00000462714 ; DHPS-002; intron 6
OTTHUMT00000462708 ; DHPS-001; intron 7
OTTHUMT00000462712 ; DHPS-006; intron 7
ENST00000600510 ; DHPS-007; exon 1
ENST00000600864 ; DHPS-021; intron 2
ENST00000598246 ; DHPS-008; intron 3
ENST00000351660 ; DHPS-003; intron 6
ENST00000601639 ; DHPS-005; intron 6
ENST00000601537 ; DHPS-002; intron 6
ENST00000210060 ; DHPS-001; intron 7
ENST00000594424 ; DHPS-006; intron 7
Database links

Mature sequence hsa-miR-5684

Accession MIMAT0022473
Sequence

5 - 

aacucuagccugagcaacag

 - 24

Get sequence
Deep sequencing230 reads, 78 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21980368 "MicroRNAs associated with metastatic prostate cancer" Watahiki A, Wang Y, Morris J, Dennis K, O'Dwyer HM, Gleave M, Gout PW, Wang Y PLoS One. 6:e24950(2011).