Stem-loop sequence hsa-mir-5683

AccessionMI0019284 (change log)
Symbol HGNC:MIR5683
DescriptionHomo sapiens miR-5683 stem-loop
Literature search

1 open access papers mention hsa-mir-5683
(1 sentences)

Stem-loop
     ag      a           u u        uu      
5' gg  cuuguu cagaugcagau c cugacuuc  acugc 
   ||  |||||| ||||||||||| | ||||||||  |||| a
3' cc  gaauaa guuuacgucua g gacugaag  ugacc 
     ca      -           - -        --      
Get sequence
Deep sequencing
1661 reads, 0 reads per million, 92 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 6169334-6169409 [+]
antisense
OTTHUMT00000039756 ; F13A1-001; intron 12
ENST00000264870 ; F13A1-001; intron 12
Clustered miRNAs
< 10kb from hsa-mir-5683
hsa-mir-7853chr6: 6169304-6169435 [-]
hsa-mir-5683chr6: 6169334-6169409 [+]
Database links

Mature sequence hsa-miR-5683

Accession MIMAT0022472
Sequence

10 - 

uacagaugcagauucucugacuuc

 - 33

Get sequence
Deep sequencing1648 reads, 91 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21980368 "MicroRNAs associated with metastatic prostate cancer" Watahiki A, Wang Y, Morris J, Dennis K, O'Dwyer HM, Gleave M, Gout PW, Wang Y PLoS One. 6:e24950(2011).