Stem-loop sequence hsa-mir-5682

AccessionMI0019282 (change log)
Symbol HGNC:MIR5682
DescriptionHomo sapiens miR-5682 stem-loop
Stem-loop
         -   gu                      a ac 
5' ggccca ugg  cuuauccugcaaggugcugcag g  g
   |||||| |||  |||||||||||||||||||||| |   
3' ccgggu auc  gaauaggacguuccacgauguc c  a
         c   ug                      - gg 
Get sequence
Deep sequencing
1041 reads, 0 reads per million, 58 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 121049640-121049715 [+]
sense
OTTHUMT00000355284 ; STXBP5L-002; intron 20
OTTHUMT00000355548 ; STXBP5L-007; intron 20
OTTHUMT00000355546 ; STXBP5L-005; intron 20
OTTHUMT00000355256 ; STXBP5L-001; intron 21
OTTHUMT00000355547 ; STXBP5L-006; intron 21
OTTHUMT00000355545 ; STXBP5L-004; intron 22
ENST00000471454 ; STXBP5L-002; intron 20
ENST00000472879 ; STXBP5L-007; intron 20
ENST00000471262 ; STXBP5L-005; intron 20
ENST00000273666 ; STXBP5L-001; intron 21
ENST00000492541 ; STXBP5L-006; intron 21
ENST00000497029 ; STXBP5L-004; intron 22
Database links

Mature sequence hsa-miR-5682

Accession MIMAT0022470
Sequence

45 - 

guagcaccuugcaggauaaggu

 - 66

Get sequence
Deep sequencing783 reads, 50 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21980368 "MicroRNAs associated with metastatic prostate cancer" Watahiki A, Wang Y, Morris J, Dennis K, O'Dwyer HM, Gleave M, Gout PW, Wang Y PLoS One. 6:e24950(2011).