Stem-loop sequence hsa-mir-5681b

AccessionMI0019293 (change log)
Symbol HGNC:MIR5681B
DescriptionHomo sapiens miR-5681b stem-loop
Gene family MIPF0001343; mir-5681
Stem-loop
         g                     a 
5' gaagag uauugccacccuuucuagucu a
   |||||| ||||||||||||||||||||| u
3' cuucuc auaacggugggaaagaucagg a
         -                     g 
Get sequence
Deep sequencing
24 reads, 0 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 74548550-74548609 [-]
sense
OTTHUMT00000379001 ; STAU2-010; intron 1
OTTHUMT00000379006 ; STAU2-006; intron 1
OTTHUMT00000379010 ; STAU2-005; intron 1
OTTHUMT00000379278 ; STAU2-026; intron 2
OTTHUMT00000378999 ; STAU2-014; intron 3
OTTHUMT00000379005 ; STAU2-004; intron 3
OTTHUMT00000379007 ; STAU2-007; intron 3
OTTHUMT00000379009 ; STAU2-003; intron 3
OTTHUMT00000379277 ; STAU2-015; intron 3
OTTHUMT00000379002 ; STAU2-011; intron 4
OTTHUMT00000379004 ; STAU2-012; intron 4
OTTHUMT00000379008 ; STAU2-002; intron 4
OTTHUMT00000379279 ; STAU2-025; intron 4
OTTHUMT00000379003 ; STAU2-009; intron 5
OTTHUMT00000379000 ; STAU2-001; intron 6
ENST00000523558 ; STAU2-010; intron 1
ENST00000521451 ; STAU2-006; intron 1
ENST00000518767 ; STAU2-005; intron 1
ENST00000521293 ; STAU2-026; intron 2
ENST00000522695 ; STAU2-014; intron 3
ENST00000521727 ; STAU2-004; intron 3
ENST00000517542 ; STAU2-007; intron 3
ENST00000518981 ; STAU2-003; intron 3
ENST00000518502 ; STAU2-015; intron 3
ENST00000521210 ; STAU2-011; intron 4
ENST00000519961 ; STAU2-012; intron 4
ENST00000522509 ; STAU2-002; intron 4
ENST00000521447 ; STAU2-025; intron 4
ENST00000355780 ; STAU2-009; intron 5
ENST00000524300 ; STAU2-001; intron 6
Clustered miRNAs
< 10kb from hsa-mir-5681b
hsa-mir-5681bchr8: 74548550-74548609 [-]
hsa-mir-5681achr8: 74548543-74548617 [+]
Database links

Mature sequence hsa-miR-5681b

Accession MIMAT0022480
Sequence

5 - 

agguauugccacccuuucuagu

 - 26

Get sequence
Deep sequencing16 reads, 11 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21980368 "MicroRNAs associated with metastatic prostate cancer" Watahiki A, Wang Y, Morris J, Dennis K, O'Dwyer HM, Gleave M, Gout PW, Wang Y PLoS One. 6:e24950(2011).