Stem-loop sequence hsa-mir-5681a

AccessionMI0019281 (change log)
Symbol HGNC:MIR5681A
DescriptionHomo sapiens miR-5681a stem-loop
Gene family MIPF0001343; mir-5681
Literature search

1 open access papers mention hsa-mir-5681a
(1 sentences)

Stem-loop
           -     -                    cc 
5' aguuuuug aagag uauugccacccuuucuaguc  u
   |||||||| ||||| ||||||||||||||||||||  a
3' ucaaaaac uucuc auaacggugggaaagaucag  u
           c     c                    au 
Get sequence
Deep sequencing
52 reads, 0 reads per million, 29 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 74548543-74548617 [+]
antisense
OTTHUMT00000379001 ; STAU2-010; intron 1
OTTHUMT00000379006 ; STAU2-006; intron 1
OTTHUMT00000379010 ; STAU2-005; intron 1
OTTHUMT00000379278 ; STAU2-026; intron 2
OTTHUMT00000378999 ; STAU2-014; intron 3
OTTHUMT00000379005 ; STAU2-004; intron 3
OTTHUMT00000379007 ; STAU2-007; intron 3
OTTHUMT00000379009 ; STAU2-003; intron 3
OTTHUMT00000379277 ; STAU2-015; intron 3
OTTHUMT00000379002 ; STAU2-011; intron 4
OTTHUMT00000379004 ; STAU2-012; intron 4
OTTHUMT00000379008 ; STAU2-002; intron 4
OTTHUMT00000379279 ; STAU2-025; intron 4
OTTHUMT00000379003 ; STAU2-009; intron 5
OTTHUMT00000379000 ; STAU2-001; intron 6
ENST00000523558 ; STAU2-010; intron 1
ENST00000521451 ; STAU2-006; intron 1
ENST00000518767 ; STAU2-005; intron 1
ENST00000521293 ; STAU2-026; intron 2
ENST00000522695 ; STAU2-014; intron 3
ENST00000521727 ; STAU2-004; intron 3
ENST00000517542 ; STAU2-007; intron 3
ENST00000518981 ; STAU2-003; intron 3
ENST00000518502 ; STAU2-015; intron 3
ENST00000521210 ; STAU2-011; intron 4
ENST00000519961 ; STAU2-012; intron 4
ENST00000522509 ; STAU2-002; intron 4
ENST00000521447 ; STAU2-025; intron 4
ENST00000355780 ; STAU2-009; intron 5
ENST00000524300 ; STAU2-001; intron 6
Clustered miRNAs
< 10kb from hsa-mir-5681a
hsa-mir-5681achr8: 74548543-74548617 [+]
hsa-mir-5681bchr8: 74548550-74548609 [-]
Database links

Mature sequence hsa-miR-5681a

Accession MIMAT0022469
Sequence

45 - 

agaaaggguggcaauaccucuu

 - 66

Get sequence
Deep sequencing43 reads, 24 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21980368 "MicroRNAs associated with metastatic prostate cancer" Watahiki A, Wang Y, Morris J, Dennis K, O'Dwyer HM, Gleave M, Gout PW, Wang Y PLoS One. 6:e24950(2011).