Stem-loop sequence hsa-mir-5680

AccessionMI0019280
Symbol HGNC:MIR5680
DescriptionHomo sapiens miR-5680 stem-loop
Stem-loop
                       c          c       ga 
5' gcauuggguuagcagguuag ccagcauuuc cuuccug  c
   |||||||||||||||||||| |||||||||| |||||||   
3' cguaaccuaaucgucuaauc ggucguaaag ggaggac  a
                       a          a       ac 
Get sequence
Deep sequencing
15 reads, 42 reads per million, 13 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chr8: 102125432-102125515 [+]
intergenic
Database links

Mature sequence hsa-miR-5680

Accession MIMAT0022468
Sequence

52 - 

gagaaaugcuggacuaaucugc

 - 73

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21980368 "MicroRNAs associated with metastatic prostate cancer" Watahiki A, Wang Y, Morris J, Dennis K, O'Dwyer HM, Gleave M, Gout PW, Wang Y PLoS One. 6:e24950(2011).