Stem-loop sequence hsa-mir-5680

AccessionMI0019280 (change log)
Symbol HGNC:MIR5680
DescriptionHomo sapiens miR-5680 stem-loop
                       c          c       ga 
5' gcauuggguuagcagguuag ccagcauuuc cuuccug  c
   |||||||||||||||||||| |||||||||| |||||||   
3' cguaaccuaaucgucuaauc ggucguaaag ggaggac  a
                       a          a       ac 
Get sequence
Deep sequencing
10 reads, 0 reads per million, 8 experiments
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 102125432-102125515 [+]
Database links

Mature sequence hsa-miR-5680

Accession MIMAT0022468

52 - 


 - 73

Get sequence
Deep sequencing6 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets


PMID:21980368 "MicroRNAs associated with metastatic prostate cancer" Watahiki A, Wang Y, Morris J, Dennis K, O'Dwyer HM, Gleave M, Gout PW, Wang Y PLoS One. 6:e24950(2011).