Stem-loop sequence hsa-mir-5591

AccessionMI0019151 (change log)
Symbol HGNC:MIR5591
DescriptionHomo sapiens miR-5591 stem-loop
Stem-loop
   u                    a u  -  uua 
5'  gggagcuaagcuauggguau c ga gc   u
    |||||||||||||||||||| | || ||    
3'  cccucgauucgauacccaua g cu cg   g
   a                    c u  a  uau 
Get sequence
Deep sequencing
8 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr4: 39411910-39411974 [+]
sense
OTTHUMT00000250429 ; KLB-001; intron 1
ENST00000257408 ; KLB-001; intron 1
Database links

Mature sequence hsa-miR-5591-5p

Accession MIMAT0022301
Sequence

1 - 

ugggagcuaagcuauggguau

 - 21

Get sequence
Deep sequencing4 reads, 4 experiments
Evidence not experimental
Predicted targets

Mature sequence hsa-miR-5591-3p

Accession MIMAT0022302
Sequence

45 - 

auacccauagcuuagcuccca

 - 65

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence not experimental
Predicted targets

References

1
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).