Stem-loop sequence hsa-mir-5590

AccessionMI0019150 (change log)
Symbol HGNC:MIR5590
DescriptionHomo sapiens miR-5590 stem-loop
Stem-loop
   u          ag          guu 
5'  ugccauacau  acuuuauugu   g
    ||||||||||  ||||||||||    
3'  acgguaugua  ugaaauaaca   a
   a          cu          acu 
Get sequence
Deep sequencing
9 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 134857820-134857873 [+]
intergenic
Database links

Mature sequence hsa-miR-5590-5p

Accession MIMAT0022299
Sequence

1 - 

uugccauacauagacuuuauu

 - 21

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence not experimental
Predicted targets

Mature sequence hsa-miR-5590-3p

Accession MIMAT0022300
Sequence

34 - 

aauaaaguucauguauggcaa

 - 54

Get sequence
Deep sequencing6 reads, 2 experiments
Evidence not experimental
Predicted targets

References

1
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).