Stem-loop sequence hsa-mir-5589

AccessionMI0019148 (change log)
Symbol HGNC:MIR5589
DescriptionHomo sapiens miR-5589 stem-loop
Stem-loop
   ----        -   cu        gagcaa 
5'     ggcugggu gcu  ugugcagu      c
       |||||||| |||  ||||||||       
3'     ucgaucca cgg  acacguca      c
   accc        a   -u        acacau 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 10038354-10038413 [+]
antisense
OTTHUMT00000451119 ; OLFM2-001; intron 1
OTTHUMT00000451123 ; OLFM2-004; intron 1
ENST00000264833 ; OLFM2-001; intron 1
ENST00000590410 ; OLFM2-004; intron 1
Database links

Mature sequence hsa-miR-5589-5p

Accession MIMAT0022297
Sequence

1 - 

ggcugggugcucuugugcagu

 - 21

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence not experimental
Predicted targets

Mature sequence hsa-miR-5589-3p

Accession MIMAT0022298
Sequence

38 - 

ugcacauggcaaccuagcuccca

 - 60

Get sequence
Evidence not experimental
Predicted targets

References

1
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).