Stem-loop sequence hsa-mir-5588

AccessionMI0019147 (change log)
Symbol HGNC:MIR5588
DescriptionHomo sapiens miR-5588 stem-loop
Stem-loop
   a                    uuuuuuuuu 
5'  cuggcauuagugggacuuuu         u
    ||||||||||||||||||||         u
3'  gaccguaaucacccugaaaa         u
   c                    uuguaauuu 
Get sequence
Deep sequencing
2178 reads, 97.7 reads per million, 130 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 185253210-185253272 [-]
sense
OTTHUMT00000345153 ; LIPH-001; intron 1
OTTHUMT00000345154 ; LIPH-002; intron 1
OTTHUMT00000345156 ; LIPH-004; intron 2
ENST00000296252 ; LIPH-001; intron 1
ENST00000424591 ; LIPH-002; intron 1
ENST00000429510 ; LIPH-004; intron 2
Database links

Mature sequence hsa-miR-5588-5p

Accession MIMAT0022295
Sequence

1 - 

acuggcauuagugggacuuuu

 - 21

Get sequence
Deep sequencing229 reads, 62 experiments
Evidence not experimental
Database links
Predicted targets

Mature sequence hsa-miR-5588-3p

Accession MIMAT0022296
Sequence

45 - 

aagucccacuaaugccagc

 - 63

Get sequence
Deep sequencing124 reads, 11 experiments
Evidence not experimental
Predicted targets

References

1
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).