Stem-loop sequence hsa-mir-5586

AccessionMI0019143 (change log)
Symbol HGNC:MIR5586
DescriptionHomo sapiens miR-5586 stem-loop
Stem-loop
   ---uau             aua      uu 
5'       ccagcuuguuacu   ugcuuu  a
         |||||||||||||   ||||||   
3'       ggucgaacaguga   acgggg  a
   gaaauu             gac      ua 
Get sequence
Deep sequencing
87 reads, 0 reads per million, 36 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 59646962-59647020 [-]
intergenic
Database links

Mature sequence hsa-miR-5586-5p

Accession MIMAT0022287
Sequence

1 - 

uauccagcuuguuacuauaugc

 - 22

Get sequence
Deep sequencing33 reads, 18 experiments
Evidence not experimental
Predicted targets

Mature sequence hsa-miR-5586-3p

Accession MIMAT0022288
Sequence

38 - 

cagagugacaagcugguuaaag

 - 59

Get sequence
Deep sequencing52 reads, 20 experiments
Evidence not experimental
Predicted targets

References

1
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).