Stem-loop sequence hsa-mir-5585

AccessionMI0019142 (change log)
Symbol HGNC:MIR5585
DescriptionHomo sapiens miR-5585 stem-loop
Literature search

2 open access papers mention hsa-mir-5585
(26 sentences)

Stem-loop
   ---  a   a       c  --   ag   a 
5'    ug agu ccagcua uc  gag  guc g
      || ||| ||||||| ||  |||  |||  
3'    ac uca ggucgau ag  cuc  uag a
   ugg  a   g       a  uc   gu   g 
Get sequence
Deep sequencing
1592 reads, 320 reads per million, 142 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 32086949-32087007 [+]
sense
OTTHUMT00000011042 ; HCRTR1-001; intron 3
OTTHUMT00000011043 ; HCRTR1-002; intron 3
OTTHUMT00000011045 ; HCRTR1-004; intron 4
OTTHUMT00000011044 ; HCRTR1-003; intron 5
ENST00000373706 ; HCRTR1-001; intron 3
ENST00000373705 ; HCRTR1-002; intron 3
ENST00000485464 ; HCRTR1-004; intron 4
ENST00000468521 ; HCRTR1-003; intron 5
ENST00000403528 ; HCRTR1-201; intron 5
Database links

Mature sequence hsa-miR-5585-5p

Accession MIMAT0022285
Sequence

1 - 

ugaaguaccagcuacucgagag

 - 22

Get sequence
Deep sequencing190 reads, 67 experiments
Evidence not experimental
Predicted targets

Mature sequence hsa-miR-5585-3p

Accession MIMAT0022286
Sequence

38 - 

cugaauagcugggacuacaggu

 - 59

Get sequence
Deep sequencing1396 reads, 139 experiments
Evidence not experimental
Database links
Predicted targets

References

1
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).