Stem-loop sequence hsa-mir-5584

AccessionMI0019141 (change log)
Symbol HGNC:MIR5584
DescriptionHomo sapiens miR-5584 stem-loop
Stem-loop
   --ca   aaau             --    a 
5'     ggg    gggaagaacuaga  uuug a
       |||    |||||||||||||  ||||  
3'     ccc    cccuucuugauuu  agac u
   uuaa   guuu             cc    c 
Get sequence
Deep sequencing
419 reads, 0 reads per million, 35 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 44545493-44545552 [+]
sense
OTTHUMT00000022875 ; RP5-1198O20.4-001; intron 5
ENST00000434244 ; RP5-1198O20.4-001; intron 5
Database links

Mature sequence hsa-miR-5584-5p

Accession MIMAT0022283
Sequence

1 - 

cagggaaaugggaagaacuaga

 - 22

Get sequence
Deep sequencing408 reads, 29 experiments
Evidence not experimental
Predicted targets

Mature sequence hsa-miR-5584-3p

Accession MIMAT0022284
Sequence

39 - 

uaguucuucccuuugcccaauu

 - 60

Get sequence
Deep sequencing5 reads, 4 experiments
Evidence not experimental
Predicted targets

References

1
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).