Stem-loop sequence hsa-mir-5583-1

AccessionMI0019139 (change log)
Symbol HGNC:MIR5583-1
DescriptionHomo sapiens miR-5583-1 stem-loop
Gene family MIPF0001356; mir-5583
Stem-loop
   --                       cuag 
5'   aaacuaauauacccauauucugg    g
     |||||||||||||||||||||||    u
3'   uuugauuauauggguauaagacu    g
   gg                       acua 
Get sequence
Deep sequencing
327 reads, 0 reads per million, 18 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr18: 39676721-39676779 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-5583-1
hsa-mir-5583-2chr18: 39676719-39676777 [-]
hsa-mir-5583-1chr18: 39676721-39676779 [+]
Database links

Mature sequence hsa-miR-5583-5p

Accession MIMAT0022281
Sequence

1 - 

aaacuaauauacccauauucug

 - 22

Get sequence
Deep sequencing264 reads, 16 experiments
Evidence not experimental
Predicted targets

Mature sequence hsa-miR-5583-3p

Accession MIMAT0022282
Sequence

38 - 

gaauauggguauauuaguuugg

 - 59

Get sequence
Deep sequencing390 reads, 16 experiments
Evidence not experimental
Predicted targets

References

1
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).