Stem-loop sequence hsa-mir-5582

AccessionMI0019138 (change log)
Symbol HGNC:MIR5582
DescriptionHomo sapiens miR-5582 stem-loop
Stem-loop
   --                 a     acauc   u 
5'   uaggcacacuuaaaguu uagcu     agu a
     ||||||||||||||||| |||||     |||  
3'   auccgugugaauuucaa auuga     uca u
   gg                 a     cuaua   a 
Get sequence
Deep sequencing
313 reads, 0 reads per million, 46 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 46753125-46753192 [-]
antisense
OTTHUMT00000317706 ; F2-001; intron 12
OTTHUMT00000390677 ; F2-005; intron 12
ENST00000311907 ; F2-001; intron 12
ENST00000530231 ; F2-005; intron 12
Database links

Mature sequence hsa-miR-5582-5p

Accession MIMAT0022279
Sequence

1 - 

uaggcacacuuaaaguuauagc

 - 22

Get sequence
Deep sequencing15 reads, 4 experiments
Evidence not experimental
Predicted targets

Mature sequence hsa-miR-5582-3p

Accession MIMAT0022280
Sequence

47 - 

uaaaacuuuaagugugccuagg

 - 68

Get sequence
Deep sequencing298 reads, 45 experiments
Evidence not experimental
Predicted targets

References

1
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).