Stem-loop sequence hsa-mir-5581

AccessionMI0019136 (change log)
Symbol HGNC:MIR5581
DescriptionHomo sapiens miR-5581 stem-loop
Literature search

1 open access papers mention hsa-mir-5581
(1 sentences)

Stem-loop
   -agc    c     aa        ccuau 
5'     cuuc aggag  auggagac     a
       |||| |||||  ||||||||     c
3'     gaag uccuc  uaccuuug     a
   ccuu    a     cg        uccau 
Get sequence
Deep sequencing
323 reads, 0 reads per million, 55 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 37500935-37500994 [-]
intergenic
Database links

Mature sequence hsa-miR-5581-5p

Accession MIMAT0022275
Sequence

1 - 

agccuuccaggagaaauggaga

 - 22

Get sequence
Deep sequencing68 reads, 21 experiments
Evidence not experimental
Predicted targets

Mature sequence hsa-miR-5581-3p

Accession MIMAT0022276
Sequence

39 - 

uuccaugccuccuagaaguucc

 - 60

Get sequence
Deep sequencing255 reads, 47 experiments
Evidence not experimental
Predicted targets

References

1
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).