Stem-loop sequence hsa-mir-5580

AccessionMI0019135 (change log)
Symbol HGNC:MIR5580
DescriptionHomo sapiens miR-5580 stem-loop
Stem-loop
   -                       cuga 
5'  ugcuggcucauuucauaugugug    g
    |||||||||||||||||||||||    a
3'  acgaccgagugaaguauacacac    a
   c                       uuaa 
Get sequence
Deep sequencing
70 reads, 0 reads per million, 23 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 53948427-53948484 [-]
antisense
OTTHUMT00000316369 ; AL163953.3-002; intron 1
OTTHUMT00000257957 ; AL163953.3-001; intron 3
ENST00000425648 ; AL163953.3-002; intron 1
ENST00000456100 ; AL163953.3-001; intron 3
Database links

Mature sequence hsa-miR-5580-5p

Accession MIMAT0022273
Sequence

1 - 

ugcuggcucauuucauaugugu

 - 22

Get sequence
Deep sequencing19 reads, 12 experiments
Evidence not experimental
Predicted targets

Mature sequence hsa-miR-5580-3p

Accession MIMAT0022274
Sequence

37 - 

cacauaugaagugagccagcac

 - 58

Get sequence
Deep sequencing49 reads, 14 experiments
Evidence not experimental
Predicted targets

References

1
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).