Stem-loop sequence hsa-mir-5579

AccessionMI0019133 (change log)
Symbol HGNC:MIR5579
DescriptionHomo sapiens miR-5579 stem-loop
Stem-loop
   --ua                 ------    g 
5'     ugguacuccuuaagcua      acag c
       |||||||||||||||||      ||||  
3'     accaugaggaauucgau      uguc c
   cuag                 uaccac    c 
Get sequence
Deep sequencing
123 reads, 0 reads per million, 34 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 79422169-79422226 [-]
intergenic
Database links

Mature sequence hsa-miR-5579-5p

Accession MIMAT0022269
Sequence

1 - 

uaugguacuccuuaagcuaac

 - 21

Get sequence
Deep sequencing61 reads, 20 experiments
Evidence not experimental
Predicted targets

Mature sequence hsa-miR-5579-3p

Accession MIMAT0022270
Sequence

37 - 

uuagcuuaaggaguaccagauc

 - 58

Get sequence
Deep sequencing57 reads, 19 experiments
Evidence not experimental
Predicted targets

References

1
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).