Stem-loop sequence hsa-mir-5572

AccessionMI0019117 (change log)
Symbol HGNC:MIR5572
DescriptionHomo sapiens miR-5572 stem-loop
Stem-loop
   -----agc   -    ----     uc    gg   cacu    a  cag     gcacu         -a      u  g 
5'         cag acaa    gaggg  augg  agu    guca cc   agcag     gccccugcg  ccagcc gg g
           ||| ||||    |||||  ||||  |||    |||| ||   |||||     |||||||||  |||||| ||  
3'         guc uguu    uucuc  uacc  ucg    uagu gg   ucguc     uggggacgu  gguugg cu c
   cgauguua   c    ucgu     --    uu   ----    -  ---     -----         gg      -  a 
Get sequence
Deep sequencing
33 reads, 94.7 reads per million, 19 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr15: 80581103-80581239 [+]
antisense
OTTHUMT00000417169 ; RP11-210M15.3-004; intron 1
OTTHUMT00000417163 ; RP11-210M15.3-002; intron 1
ENST00000558913 ; LINC00927-004; intron 1
ENST00000558244 ; LINC00927-002; intron 1
Database links

Mature sequence hsa-miR-5572

Accession MIMAT0022260
Sequence

77 - 

guuggggugcaggggucugcu

 - 97

Get sequence
Deep sequencing7 reads, 6 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:21895886 "Deep sequencing of short RNAs reveals novel microRNAs in minor salivary glands of patients with Sjogren's syndrome" Tandon M, Gallo A, Jang SI, Illei GG, Alevizos I Oral Dis. 18:127-131(2012).