Stem-loop sequence hsa-mir-5571

AccessionMI0019115 (change log)
Symbol HGNC:MIR5571
DescriptionHomo sapiens miR-5571 stem-loop
Literature search

1 open access papers mention hsa-mir-5571
(2 sentences)

Stem-loop
   aucu   a aa     --gaacca           a          c    aa   ac 
5'     gac c  aaugu        agcaauucuca aggagccucc agga  uuc  u
       ||| |  |||||        ||||||||||| |||||||||| ||||  |||   
3'     cug g  uuaca        ucguugagagu uccucggagg uccu  agg  u
   ---c   a ag     aaacaaaa           c          a    ga   au 
Get sequence
Deep sequencing
386 reads, 22.6 reads per million, 62 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr22: 22886267-22886379 [+]
intergenic
Database links

Mature sequence hsa-miR-5571-5p

Accession MIMAT0022257
Sequence

25 - 

caauucucaaaggagccuccc

 - 45

Get sequence
Deep sequencing202 reads, 22 experiments
Evidence experimental; SOLiD [1]
Database links
Predicted targets

Mature sequence hsa-miR-5571-3p

Accession MIMAT0022258
Sequence

65 - 

guccuaggaggcuccucug

 - 83

Get sequence
Deep sequencing149 reads, 49 experiments
Evidence experimental; SOLiD [1]
Database links
Predicted targets

References

1
PMID:21895886 "Deep sequencing of short RNAs reveals novel microRNAs in minor salivary glands of patients with Sjogren's syndrome" Tandon M, Gallo A, Jang SI, Illei GG, Alevizos I Oral Dis. 18:127-131(2012).