Stem-loop sequence hsa-mir-557

AccessionMI0003563 (change log)
Symbol HGNC:MIR557
DescriptionHomo sapiens miR-557 stem-loop
Gene family MIPF0000520; mir-557
Literature search

3 open access papers mention hsa-mir-557
(21 sentences)

Stem-loop
   agaaugggcaaaugaacaguaaa  ug     cu       u   -   ---u   g 
5'                        uu  gaggc  ggggccc ccc ugc    gcu g
                          ||  |||||  ||||||| ||| |||    ||| a
3'                        aa  uucug  uuccggg ggg acg    uga g
   -------------agguggagga  gu     --       u   c   uuug   a 
Get sequence
Deep sequencing
6 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 168375524-168375621 [+]
antisense
OTTHUMT00000097958 ; RP5-968D22.1-002; intron 1
OTTHUMT00000083820 ; RP5-968D22.1-001; intron 3
ENST00000422548 ; RP5-968D22.1-002; intron 1
ENST00000441851 ; RP5-968D22.1-001; intron 3
Database links

Mature sequence hsa-miR-557

Accession MIMAT0003221
Sequence

61 - 

guuugcacgggugggccuugucu

 - 83

Get sequence
Evidence experimental; Microarray [1], SAGE [1]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).