Stem-loop sequence hsa-mir-555

AccessionMI0003561 (change log)
Symbol HGNC:MIR555
DescriptionHomo sapiens miR-555 stem-loop
Gene family MIPF0000583; mir-555
Literature search

3 open access papers mention hsa-mir-555
(5 sentences)

Stem-loop
   -------     gaac     u  gg   ac      u  ga    u  gac 
5'        ggagu    ucaga gu  agc  uaccuu gu  gcag gu   c
          |||||    ||||| ||  |||  |||||| ||  |||| ||    
3'        ucuca    agucu ca  ucg  auggga ca  uguc cg   c
   uaucuag     aaau     c  ag   -a      -  gg    -  gaa 
Get sequence
Deep sequencing
104 reads, 0 reads per million, 50 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 155346350-155346445 [-]
sense
OTTHUMT00000039400 ; ASH1L-001; intron 10
OTTHUMT00000039401 ; ASH1L-002; intron 10
ENST00000368346 ; ASH1L-001; intron 10
ENST00000392403 ; ASH1L-002; intron 10
Database links

Mature sequence hsa-miR-555

Accession MIMAT0003219
Sequence

61 - 

aggguaagcugaaccucugau

 - 81

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; SAGE [1]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).