Stem-loop sequence hsa-mir-554

AccessionMI0003559 (change log)
Symbol HGNC:MIR554
DescriptionHomo sapiens miR-554 stem-loop
Gene family MIPF0000551; mir-554
Literature search

2 open access papers mention hsa-mir-554
(5 sentences)

Stem-loop
   -----a  u   uaaccuu      --------          --      a   g 
5'       cc gag       ugcuag        uccugacuca  gccagu cug u
         || |||       ||||||        ||||||||||  |||||| |||  
3'       gg cuc       acgguu        gggacugggu  ugguca gau c
   ucuacg  u   --ucucu      uuauacuu          ag      -   u 
Get sequence
Deep sequencing
30 reads, 0 reads per million, 22 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr1: 151545796-151545891 [+]
sense
OTTHUMT00000316341 ; TUFT1-011; intron 2
OTTHUMT00000316340 ; TUFT1-010; intron 5
OTTHUMT00000035023 ; TUFT1-008; intron 6
OTTHUMT00000035022 ; TUFT1-006; intron 7
ENST00000490156 ; TUFT1-011; intron 2
ENST00000392712 ; TUFT1-010; intron 5
ENST00000353024 ; TUFT1-201; intron 5
ENST00000368848 ; TUFT1-008; intron 6
ENST00000368849 ; TUFT1-006; intron 7
ENST00000538902 ; TUFT1-202; intron 8
Database links

Mature sequence hsa-miR-554

Accession MIMAT0003217
Sequence

16 - 

gcuaguccugacucagccagu

 - 36

Get sequence
Evidence experimental; SAGE [1]
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).