Stem-loop sequence hsa-mir-549a

AccessionMI0003679 (change log)
Previous IDshsa-mir-549
Symbol HGNC:MIR549A
DescriptionHomo sapiens miR-549 stem-loop
Gene family MIPF0000470; mir-549
Literature search

3 open access papers mention hsa-mir-549a
(6 sentences)

Stem-loop
   agacaugcaacucaaga                                ucu 
5'                  auauauugagagcucauccauaguugucacug   c
                    ||||||||||||||||||||||||||||||||    
3'                  uauauaauucucgaguagguaucaacagugac   a
   ----------cggaccc                                uaa 
Get sequence
Deep sequencing
255 reads, 0 reads per million, 77 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr15: 80841978-80842073 [-]
antisense
OTTHUMT00000384437 ; ARNT2-007; intron 4
OTTHUMT00000384389 ; ARNT2-001; intron 8
OTTHUMT00000384390 ; ARNT2-004; intron 8
OTTHUMT00000384436 ; ARNT2-006; intron 9
ENST00000525103 ; ARNT2-007; intron 4
ENST00000303329 ; ARNT2-001; intron 8
ENST00000527771 ; ARNT2-004; intron 8
ENST00000533983 ; ARNT2-006; intron 9
Database links

Mature sequence hsa-miR-549a-5p

Accession MIMAT0037328
Sequence

28 - 

agcucauccauaguugucacug

 - 49

Get sequence
Deep sequencing33 reads, 18 experiments
Evidence experimental; Illumina [2]

Mature sequence hsa-miR-549a-3p

Accession MIMAT0003333
Previous IDshsa-miR-549
Sequence

61 - 

ugacaacuauggaugagcucu

 - 81

Get sequence
Deep sequencing219 reads, 75 experiments
Evidence experimental; SAGE [1]
Database links
Predicted targets

References

1
PMID:16505370 "The colorectal microRNAome" Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA Jr, Sjoblom T, Barad O, Bentwich Z, Szafranska AE, Labourier E, Raymond CK, Roberts BS, Juhl H, Kinzler KW, Vogelstein B, Velculescu VE Proc Natl Acad Sci U S A. 103:3687-3692(2006).
2
PMID:25822230 "Selective microRNA-Offset RNA expression in human embryonic stem cells" Asikainen S, Heikkinen L, Juhila J, Holm F, Weltner J, Trokovic R, Mikkola M, Toivonen S, Balboa D, Lampela R, Icay K, Tuuri T, Otonkoski T, Wong G, Hovatta O PLoS One. 10:e0116668(2015).