Stem-loop sequence hsa-mir-548y

AccessionMI0016595 (change log)
Symbol HGNC:MIR548Y
DescriptionHomo sapiens miR-548y stem-loop
Gene family MIPF0000317; mir-548
Literature search

41 open access papers mention hsa-mir-548y
(141 sentences)

Stem-loop
   ----------gccuaaac                          u            ac 
5'                   uauuagguuggugcaaaaguaaucac guuuuugccauu  u
                     |||||||||||||||||||||||||| ||||||||||||   
3'                   augauccaaccacguuuucauuagug caaaaacgguga  c
   gggggugucacuuccaca                          c            cu 
Get sequence
Deep sequencing
2344 reads, 1.55 reads per million, 129 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 47760995-47761104 [-]
sense
OTTHUMT00000073352 ; MDGA2-001; intron 2
OTTHUMT00000277084 ; MDGA2-002; intron 2
OTTHUMT00000410588 ; MDGA2-008; intron 2
OTTHUMT00000410572 ; MDGA2-006; intron 2
OTTHUMT00000277089 ; MDGA2-005; intron 2
ENST00000399232 ; MDGA2-001; intron 2
ENST00000357362 ; MDGA2-002; intron 2
ENST00000557238 ; MDGA2-008; intron 2
ENST00000482848 ; MDGA2-006; intron 2
ENST00000486952 ; MDGA2-005; intron 2
ENST00000426342 ; MDGA2-202; intron 2
ENST00000439988 ; MDGA2-203; intron 2
Database links

Mature sequence hsa-miR-548y

Accession MIMAT0018354
Sequence

23 - 

aaaaguaaucacuguuuuugcc

 - 44

Get sequence
Deep sequencing717 reads, 73 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1