Stem-loop sequence hsa-mir-548x

AccessionMI0014244 (change log)
Symbol HGNC:MIR548X
DescriptionHomo sapiens miR-548x stem-loop
Gene family MIPF0000317; mir-548
Literature search

43 open access papers mention hsa-mir-548x
(144 sentences)

Stem-loop
        a   ca                     uuac 
5' agguu gug  aaaguaauugcaguuuuugcg    u
   ||||| |||  |||||||||||||||||||||    u
3' ucuaa cac  uuucauuaacgucaaaaaugc    u
        c   ac                     uaac 
Get sequence
Deep sequencing
6007 reads, 3.39 reads per million, 118 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr21: 18686090-18686164 [-]
intergenic
Database links

Mature sequence hsa-miR-548x-5p

Accession MIMAT0022733
Sequence

8 - 

ugcaaaaguaauugcaguuuuug

 - 30

Get sequence
Deep sequencing3956 reads, 121 experiments
Evidence not experimental
Database links
Predicted targets

Mature sequence hsa-miR-548x-3p

Accession MIMAT0015081
Previous IDshsa-miR-548x
Sequence

46 - 

uaaaaacugcaauuacuuuc

 - 65

Get sequence
Deep sequencing4293 reads, 87 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).