Stem-loop sequence hsa-mir-548w

AccessionMI0014222 (change log)
Symbol HGNC:MIR548W
DescriptionHomo sapiens miR-548w stem-loop
Gene family MIPF0000317; mir-548
Literature search

41 open access papers mention hsa-mir-548w
(141 sentences)

Stem-loop
                    c  c  u       uuuca 
5' gguuggugcaaaaguaa ug gg uuuugcc     a
   ||||||||||||||||| || || |||||||      
3' cuaaccacguuuucauu ac cc aaaacgg     c
                    a  a  c       uaaua 
Get sequence
Deep sequencing
7703 reads, 3.23 reads per million, 155 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr16: 26025237-26025310 [+]
sense
OTTHUMT00000133286 ; HS3ST4-001; intron 1
OTTHUMT00000276993 ; HS3ST4-002; intron 1
ENST00000331351 ; HS3ST4-001; intron 1
ENST00000475436 ; HS3ST4-002; intron 1
Database links

Mature sequence hsa-miR-548w

Accession MIMAT0015060
Sequence

10 - 

aaaaguaacugcgguuuuugccu

 - 32

Get sequence
Deep sequencing4938 reads, 152 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).