Stem-loop sequence hsa-mir-548u

AccessionMI0014168 (change log)
Symbol HGNC:MIR548U
DescriptionHomo sapiens miR-548u stem-loop
Gene family MIPF0000317; mir-548
Literature search

42 open access papers mention hsa-mir-548u
(142 sentences)

Stem-loop
         a               - ug      u  u   c 
5' auuagg uggugcaaaaguaau g  guuuuu uc uua u
   |||||| ||||||||||||||| |  |||||| || |||  
3' uaaucc accgcguuuucauua c  cagaaa gg aau u
         a               a gu      c  u   u 
Get sequence
Deep sequencing
2300 reads, 17.9 reads per million, 134 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 57390132-57390212 [+]
sense
OTTHUMT00000043470 ; PRIM2-003; intron 2
OTTHUMT00000043468 ; PRIM2-001; intron 8
ENST00000470638 ; PRIM2-003; intron 2
ENST00000389488 ; PRIM2-001; intron 8
ENST00000607273 ; PRIM2-201; intron 8
Database links

Mature sequence hsa-miR-548u

Accession MIMAT0015013
Sequence

49 - 

caaagacugcaauuacuuuugcg

 - 71

Get sequence
Deep sequencing2104 reads, 120 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).