Stem-loop sequence hsa-mir-548t

AccessionMI0014164 (change log)
Symbol HGNC:MIR548T
DescriptionHomo sapiens miR-548t stem-loop
Gene family MIPF0000317; mir-548
Literature search

41 open access papers mention hsa-mir-548t
(142 sentences)

Stem-loop
      g               c          ca   u 
5' agg uggugcaaaagugau gugguuuuug  auu u
   ||| ||||||||||||||| ||||||||||  |||  
3' ucc accacguuuucauua caccaaaaac  uaa u
      a               a          ag   u 
Get sequence
Deep sequencing
4744 reads, 2.88 reads per million, 139 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr4: 173268160-173268233 [+]
sense
OTTHUMT00000362400 ; GALNTL6-006; intron 2
OTTHUMT00000362399 ; GALNTL6-005; intron 3
OTTHUMT00000362395 ; GALNTL6-001; intron 4
ENST00000457021 ; GALNTL6-006; intron 2
ENST00000508122 ; GALNTL6-005; intron 3
ENST00000506823 ; GALNTL6-001; intron 4
Database links

Mature sequence hsa-miR-548t-5p

Accession MIMAT0015009
Previous IDshsa-miR-548t
Sequence

10 - 

caaaagugaucgugguuuuug

 - 30

Get sequence
Deep sequencing793 reads, 92 experiments
Evidence experimental; Illumina [1], Northern [2]
Database links
Predicted targets

Mature sequence hsa-miR-548t-3p

Accession MIMAT0022730
Sequence

46 - 

aaaaaccacaauuacuuuugcacca

 - 70

Get sequence
Deep sequencing3947 reads, 135 experiments
Evidence not experimental
Database links
Predicted targets

References

1
PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).
2
PMID:20532037 "Re-inspection of small RNA sequence datasets reveals several novel human miRNA genes" Hansen TB, Bramsen JB, Kjems J PLoS One. 5:e10961(2010).