Stem-loop sequence hsa-mir-548o-2

AccessionMI0016746 (change log)
Symbol HGNC:MIR548O2
DescriptionHomo sapiens miR-548o-2 stem-loop
Gene family MIPF0000317; mir-548
Literature search

41 open access papers mention hsa-mir-548o-2
(141 sentences)

Stem-loop
   u                       u   --    a 
5'  ggugcaaaaguaauugcgguuuu gcc  auua a
    ||||||||||||||||||||||| |||  ||||  
3'  ccacguuuucauugacgucaaaa cgg  uaau a
   c                       c   cg    g 
Get sequence
Deep sequencing
16902 reads, 15 reads per million, 153 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr20: 38516563-38516632 [+]
intergenic
Database links

Mature sequence hsa-miR-548o-5p

Accession MIMAT0022738
Sequence

7 - 

aaaaguaauugcgguuuuugcc

 - 28

Get sequence
Deep sequencing14253 reads, 153 experiments
Evidence not experimental
Database links
Predicted targets

Mature sequence hsa-miR-548o-3p

Accession MIMAT0005919
Previous IDshsa-miR-548o
Sequence

45 - 

ccaaaacugcaguuacuuuugc

 - 66

Get sequence
Deep sequencing5269 reads, 130 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).