Stem-loop sequence hsa-mir-548n

AccessionMI0006399 (change log)
Symbol HGNC:MIR548N
DescriptionHomo sapiens miR-548n stem-loop
Gene family MIPF0000317; mir-548
Literature search

47 open access papers mention hsa-mir-548n
(157 sentences)

Stem-loop
   --                        a      cg u 
5'   agguuggugcaaaaguaauugugg uuuugu  u a
     |||||||||||||||||||||||| ||||||  | a
3'   uccaaccacguuuucauuaacgcc aaaacg  a a
   aa                        c      au a 
Get sequence
Deep sequencing
8166 reads, 7.14 reads per million, 154 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 34940760-34940834 [-]
intergenic
Database links

Mature sequence hsa-miR-548n

Accession MIMAT0005916
Sequence

10 - 

caaaaguaauuguggauuuugu

 - 31

Get sequence
Deep sequencing6392 reads, 153 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).