Stem-loop sequence hsa-mir-548m

AccessionMI0006400 (change log)
Symbol HGNC:MIR548M
DescriptionHomo sapiens miR-548m stem-loop
Gene family MIPF0000317; mir-548
Literature search

43 open access papers mention hsa-mir-548m
(143 sentences)

Stem-loop
   --                                   u       
5'   auauuagguuggugcaaagguauuugugguuuuug cauuaa 
     ||||||||||||||||||||||||||||||||||| ||||| a
3'   uauaauccaaccacguuuccauaaacaccgaaaac guaaug 
   au                                   -       
Get sequence
Deep sequencing
211 reads, 0 reads per million, 73 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chrX: 95063141-95063226 [-]
intergenic
Database links

Mature sequence hsa-miR-548m

Accession MIMAT0005917
Sequence

15 - 

caaagguauuugugguuuuug

 - 35

Get sequence
Deep sequencing161 reads, 61 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).