Stem-loop sequence hsa-mir-548i-1

AccessionMI0006421 (change log)
Symbol HGNC:MIR548I1
DescriptionHomo sapiens miR-548i-1 stem-loop
Gene family MIPF0000317; mir-548
Literature search

42 open access papers mention hsa-mir-548i-1
(144 sentences)

Stem-loop
   -c         -----u        -----------caccc                          gga           a 
5'   agauggcuc      gaaguuug                uauuagguuggugcaaaaguaauugc   uuuugccauua a
     |||||||||      ||||||||                ||||||||||||||||||||||||||   |||||||||||  
3'   ucuaccgag      uuucaaac                augauccgaccauguuuuuauuaacg   aaaacgguaau a
   ac         ucccug        caucuuccucuuuucu                          aua           g 
Get sequence
Deep sequencing
10047 reads, 17.2 reads per million, 151 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 125790404-125790552 [-]
sense
OTTHUMT00000370519 ; SLC41A3-004; intron 1
OTTHUMT00000370051 ; SLC41A3-001; intron 1
OTTHUMT00000370886 ; SLC41A3-024; intron 1
OTTHUMT00000370053 ; SLC41A3-003; intron 1
OTTHUMT00000370672 ; SLC41A3-011; intron 1
OTTHUMT00000370052 ; SLC41A3-002; intron 1
OTTHUMT00000370675 ; SLC41A3-014; intron 1
OTTHUMT00000370709 ; SLC41A3-015; intron 1
OTTHUMT00000370763 ; SLC41A3-022; intron 1
OTTHUMT00000370713 ; SLC41A3-019; intron 1
OTTHUMT00000370761 ; SLC41A3-020; intron 1
OTTHUMT00000370762 ; SLC41A3-021; intron 1
OTTHUMT00000370885 ; SLC41A3-023; intron 1
OTTHUMT00000370673 ; SLC41A3-012; intron 1
OTTHUMT00000370674 ; SLC41A3-013; intron 1
OTTHUMT00000370711 ; SLC41A3-017; intron 2
ENST00000360370 ; SLC41A3-004; intron 1
ENST00000346785 ; SLC41A3-001; intron 1
ENST00000315891 ; SLC41A3-024; intron 1
ENST00000508835 ; SLC41A3-003; intron 1
ENST00000507008 ; SLC41A3-011; intron 1
ENST00000514677 ; SLC41A3-002; intron 1
ENST00000513723 ; SLC41A3-014; intron 1
ENST00000514023 ; SLC41A3-015; intron 1
ENST00000512470 ; SLC41A3-022; intron 1
ENST00000510651 ; SLC41A3-019; intron 1
ENST00000507280 ; SLC41A3-020; intron 1
ENST00000514891 ; SLC41A3-021; intron 1
ENST00000504035 ; SLC41A3-023; intron 1
ENST00000509064 ; SLC41A3-012; intron 1
ENST00000505996 ; SLC41A3-013; intron 1
ENST00000514333 ; SLC41A3-017; intron 2
Database links

Mature sequence hsa-miR-548i

Accession MIMAT0005935
Sequence

39 - 

aaaaguaauugcggauuuugcc

 - 60

Get sequence
Deep sequencing37421 reads, 148 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).