Stem-loop sequence hsa-mir-548h-1

AccessionMI0006411 (change log)
Symbol HGNC:MIR548H1
DescriptionHomo sapiens miR-548h-1 stem-loop
Gene family MIPF0000317; mir-548
Literature search

44 open access papers mention hsa-mir-548h-1
(148 sentences)

Stem-loop
   --    u ----c       g              cg        gu     c 
5'   ucug c     auuaggu ggugcaaaaguaau  cgguuuuu  cauua u
     |||| |     ||||||| ||||||||||||||  ||||||||  |||||  
3'   agac g     uaaucca ucacguuuucauua  gucaaaaa  guaau u
   au    c aauua       g              ag        ug     u 
Get sequence
Deep sequencing
6512 reads, 2.82 reads per million, 142 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 64095024-64095125 [-]
sense
OTTHUMT00000411879 ; WDR89-003; intron 1
OTTHUMT00000276972 ; WDR89-001; intron 1
OTTHUMT00000411880 ; WDR89-004; intron 2
ENST00000394942 ; WDR89-003; intron 1
ENST00000267522 ; WDR89-001; intron 1
ENST00000554717 ; WDR89-004; intron 2
Database links

Mature sequence hsa-miR-548h-5p

Accession MIMAT0005928
Previous IDshsa-miR-548h
Sequence

21 - 

aaaaguaaucgcgguuuuuguc

 - 42

Get sequence
Deep sequencing29178 reads, 146 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).