Stem-loop sequence hsa-mir-548h-4

AccessionMI0006414 (change log)
Symbol HGNC:MIR548H4
DescriptionHomo sapiens miR-548h-4 stem-loop
Gene family MIPF0000317; mir-548
Literature search

43 open access papers mention hsa-mir-548h-4
(147 sentences)

Stem-loop
   --  ---                       c                cuuu   uac 
5'   gc   uauuagguuggugcaaaaguaau gcgguuuuugucauua    aau   u
     ||   ||||||||||||||||||||||| ||||||||||||||||    |||    
3'   cg   auaauccaaccacguuuucauua cgccaaaaacaguaau    uug   u
   au  uuc                       a                uacu   cau 
Get sequence
Deep sequencing
12657 reads, 4.55 reads per million, 154 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 27048853-27048963 [-]
antisense
OTTHUMT00000375939 ; RP11-521M14.1-001; intron 1
ENST00000521408 ; RP11-521M14.1-001; intron 1
Database links

Mature sequence hsa-miR-548h-5p

Accession MIMAT0005928
Previous IDshsa-miR-548h
Sequence

17 - 

aaaaguaaucgcgguuuuuguc

 - 38

Get sequence
Deep sequencing29178 reads, 146 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence hsa-miR-548h-3p

Accession MIMAT0022723
Sequence

71 - 

caaaaaccgcaauuacuuuugca

 - 93

Get sequence
Deep sequencing6202 reads, 128 experiments
Evidence not experimental
Database links
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).