Stem-loop sequence hsa-mir-548g

AccessionMI0006395 (change log)
Symbol HGNC:MIR548G
DescriptionHomo sapiens miR-548g stem-loop
Gene family MIPF0000317; mir-548
Literature search

41 open access papers mention hsa-mir-548g
(142 sentences)

Stem-loop
   -agu     ga  a                      u  auuac 
5'     uauua  uu gugcaaaaguaauugcaguuuu gc     g
       |||||  || |||||||||||||||||||||| ||     u
3'     auaau  aa cauguuuucauuaaugucaaaa cg     u
   cuuc     ac  c                      -  guauc 
Get sequence
Deep sequencing
4370 reads, 0.833 reads per million, 120 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr4: 147344629-147344717 [-]
sense
OTTHUMT00000364919 ; SLC10A7-008; intron 3
OTTHUMT00000364913 ; SLC10A7-002; intron 4
OTTHUMT00000364912 ; SLC10A7-001; intron 5
OTTHUMT00000366932 ; SLC10A7-009; intron 5
ENST00000507560 ; SLC10A7-008; intron 3
ENST00000432059 ; SLC10A7-002; intron 4
ENST00000264986 ; SLC10A7-201; intron 4
ENST00000335472 ; SLC10A7-001; intron 5
ENST00000507030 ; SLC10A7-009; intron 5
ENST00000394062 ; SLC10A7-202; intron 5
Database links

Mature sequence hsa-miR-548g-5p

Accession MIMAT0022722
Sequence

15 - 

ugcaaaaguaauugcaguuuuug

 - 37

Get sequence
Deep sequencing3949 reads, 120 experiments
Evidence not experimental
Database links
Predicted targets

Mature sequence hsa-miR-548g-3p

Accession MIMAT0005912
Previous IDshsa-miR-548g
Sequence

54 - 

aaaacuguaauuacuuuuguac

 - 75

Get sequence
Deep sequencing419 reads, 56 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).