Stem-loop sequence hsa-mir-548f-1

AccessionMI0006374 (change log)
Symbol HGNC:MIR548F1
DescriptionHomo sapiens miR-548f-1 stem-loop
Gene family MIPF0000317; mir-548
Literature search

46 open access papers mention hsa-mir-548f-1
(146 sentences)

Stem-loop
   --           g          c          acauuac 
5'   auuagguuggu caaaaguaau acaguuuuug       u
     ||||||||||| |||||||||| ||||||||||        
3'   uaauccaacca guuuucauua ugucaaaaac       u
   ga           g          a          agaaacu 
Get sequence
Deep sequencing
3307 reads, 3.33 reads per million, 120 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr10: 54607874-54607957 [-]
intergenic
Database links

Mature sequence hsa-miR-548f-5p

Accession MIMAT0026739
Sequence

11 - 

ugcaaaaguaaucacaguuuuu

 - 32

Get sequence
Deep sequencing1244 reads, 80 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence hsa-miR-548f-3p

Accession MIMAT0005895
Sequence

51 - 

aaaaacuguaauuacuuuu

 - 69

Get sequence
Deep sequencing9577 reads, 124 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).