Stem-loop sequence hsa-mir-548e

AccessionMI0006344 (change log)
Symbol HGNC:MIR548E
DescriptionHomo sapiens miR-548e stem-loop
Gene family MIPF0000317; mir-548
Literature search

45 open access papers mention hsa-mir-548e
(193 sentences)

Stem-loop
   --             a      caa  g           a   c 
5'   uuauuagguuggu caaaag   uc cgguuuuugcu uua u
     ||||||||||||| ||||||   || ||||||||||| |||  
3'   gauaguccaacca guuuuc   ag gucaaaaacgg aau u
   aa             c      auc  a           a   u 
Get sequence
Deep sequencing
12078 reads, 14.5 reads per million, 145 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr10: 110988926-110989013 [+]
intergenic
Database links

Mature sequence hsa-miR-548e-5p

Accession MIMAT0026736
Sequence

15 - 

caaaagcaaucgcgguuuuugc

 - 36

Get sequence
Deep sequencing3181 reads, 105 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence hsa-miR-548e-3p

Accession MIMAT0005874
Sequence

53 - 

aaaaacugagacuacuuuugca

 - 74

Get sequence
Deep sequencing8860 reads, 141 experiments
Evidence experimental; Illumina [1-2]
Database links
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).