Stem-loop sequence hsa-mir-548bb

AccessionMI0029321 (change log)
Symbol HGNC:MIR548BB
DescriptionHomo sapiens miR-548bb stem-loop
Gene family MIPF0000317; mir-548
Literature search

41 open access papers mention hsa-mir-548bb
(141 sentences)

Stem-loop
   u   a                          g 
5'  uag uuggugcaaaaguaacuaugguuuuu c
    ||| ||||||||||||||||||||||||||  
3'  auc aaccacguuuucauugauaccaaaaa c
   a   g                          c 
Get sequence
Deep sequencing
572 reads, 0 reads per million, 84 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 60617805-60617870 [-]
sense
OTTHUMT00000351424 ; FHIT-001; intron 4
OTTHUMT00000351649 ; FHIT-003; intron 4
OTTHUMT00000351648 ; FHIT-002; intron 4
OTTHUMT00000351653 ; FHIT-007; intron 5
OTTHUMT00000351650 ; FHIT-004; intron 5
ENST00000476844 ; FHIT-001; intron 4
ENST00000492590 ; FHIT-003; intron 4
ENST00000468189 ; FHIT-002; intron 4
ENST00000488467 ; FHIT-007; intron 5
ENST00000490952 ; FHIT-004; intron 5
Database links

Mature sequence hsa-miR-548bb-5p

Accession MIMAT0035703
Sequence

13 - 

aaaaguaacuaugguuuuugcc

 - 34

Get sequence
Deep sequencing459 reads, 69 experiments
Evidence experimental; cloned [1]
Predicted targets

Mature sequence hsa-miR-548bb-3p

Accession MIMAT0035704
Sequence

35 - 

caaaaaccauaguuacuuuugc

 - 56

Get sequence
Deep sequencing71 reads, 27 experiments
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:24556720 "Identification of a tumor-suppressive human-specific microRNA within the FHIT tumor-suppressor gene" Hu B, Ying X, Wang J, Piriyapongsa J, Jordan IK, Sheng J, Yu F, Zhao P, Li Y, Wang H, Ng WL, Hu S, Wang X, Wang C, Zheng X, Li W, Curran WJ, Wang Y Cancer Res. 74:2283-2294(2014).