Stem-loop sequence hsa-mir-548ba

AccessionMI0025747 (change log)
Symbol HGNC:MIR548BA
DescriptionHomo sapiens miR-548ba stem-loop
Gene family MIPF0000317; mir-548
Literature search

41 open access papers mention hsa-mir-548ba
(141 sentences)

Stem-loop
   a       c   ga            g 
5'  aagguaa ugu  uuuuugcuauua a
    ||||||| |||  |||||||||||| a
3'  uuucauu acg  aaaaacgguaau a
   -       a   uc            g 
Get sequence
Deep sequencing
7798 reads, 8.8 reads per million, 125 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 49059603-49059658 [+]
intergenic
Database links

Mature sequence hsa-miR-548ba

Accession MIMAT0031175
Sequence

1 - 

aaagguaacugugauuuuugcu

 - 22

Get sequence
Deep sequencing4733 reads, 79 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23660593 "Research resource: small RNA-seq of human granulosa cells reveals miRNAs in FSHR and aromatase genes" Velthut-Meikas A, Simm J, Tuuri T, Tapanainen JS, Metsis M, Salumets A Mol Endocrinol. 27:1128-1141(2013).