Stem-loop sequence hsa-mir-548az

AccessionMI0022212 (change log)
Symbol HGNC:MIR548AZ
DescriptionHomo sapiens miR-548az stem-loop
Gene family MIPF0000317; mir-548
Literature search

56 open access papers mention hsa-mir-548az
(170 sentences)

Stem-loop
   agauug                         ug             c 
5'       uauuagguuggugcaaaagugauug  guuuuugcuguua u
         |||||||||||||||||||||||||  |||||||||||||  
3'       auaauccaaccacguuuucacuaac  caaaaacgguaau u
   -uuuaa                         gu             u 
Get sequence
Deep sequencing
6811 reads, 8.5 reads per million, 153 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 119325171-119325265 [+]
sense
OTTHUMT00000132996 ; AC023590.1-005; intron 1
ENST00000430457 ; AC023590.1-005; intron 1
antisense
OTTHUMT00000381869 ; SAMD12-006; intron 3
OTTHUMT00000381870 ; SAMD12-003; intron 3
OTTHUMT00000330658 ; SAMD12-005; intron 3
ENST00000453675 ; SAMD12-006; intron 3
ENST00000524796 ; SAMD12-003; intron 3
ENST00000445741 ; SAMD12-005; intron 3
ENST00000409003 ; SAMD12-201; intron 4
Database links

Mature sequence hsa-miR-548az-5p

Accession MIMAT0025456
Sequence

20 - 

caaaagugauugugguuuuugc

 - 41

Get sequence
Deep sequencing5373 reads, 153 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-548az-3p

Accession MIMAT0025457
Sequence

58 - 

aaaaacugcaaucacuuuugc

 - 78

Get sequence
Deep sequencing1298 reads, 100 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:21807764 "Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome" Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM Hum Mol Genet. 20:4025-4040(2011).